Only a few steps are required to modify the genome with Cas9-triggered homologous recombination. 
Expand the items below to view a protocol for each step, or download our Cloning Guide and Injection Protocols.

▾  Construct design and cloning

Preparing constructs for Cas9-triggered homologous recombination involves 3 steps:
  1. Design and construct the homologous repair template.  This plasmid contains the desired genome modifications, along with a selectable marker, flanked by unmodified recombination arms.  See the Construct Designs page for ideas and examples of repair templates.
  2. Choose the Cas9 target site, where the double strand break that triggers homologous recombination will occur.
  3. Put the Cas9 targeting sequence into the Cas9-sgRNA plasmid

1)  Homologous repair template 
Two examples of homologous repair templates are shown at right.  Each contains several pieces: a 5' recombination arm; some modified sequence that depends on the experiment; a selectable marker; and a 3' recombination arm.  

Homologous repair template construction
  • Start by designing the desired genomic modification and make a sketch of the modified locus.  Using a DNA sequence editor, generate a file that contains the sequence of the locus in its desired final state.  The Construct Designs page has example sequence files for several repair template designs.
  • We mainly use unc-119 selection in the lab, but other selectable markers could likely be substituted. If you wish to remove the selectable marker later, flank it with LoxP sites 
    (5’-ATAACTTCGTATAGCATACATTATACGAAGTTAT-3’). 
  • IMPORTANT:  Ensure that the Cas9 target sequence (see below) is NOT present in the homologous repair template.  Otherwise, Cas9 will cleave your repair template in addition to the genomic DNA, and recombination efficiency will suffer.  If the targeting sequence is part of a coding region then you will need to introduce silent mutations to block cleavage.  If possible, the simplest and most effective approach is to mutate the PAM (NGG motif), since this motif is absolutely required for cleavage of a substrate by Cas9.  If a PAM mutation is not feasible, introduce at least 5–6 mutations in the target sequence.  Mutations closer to the 3’ end of the targeting sequence are more likely to prevent cleavage.  
  • The actual construction of the repair template is done in two steps (see the figure at right): 
  • PCR-amplify a 3–4 kb genomic region, centered on the desired modification, from N2 genomic DNA.  We aim to have ~1.5 kb of unmodified sequence at each end of our homologous repair template to allow homologous recombination.  Clone the genomic fragment into any suitable vector (we use the ZeroBlunt TOPO kit from Life Technologies).
  • Build the modifications you want into your cloned genomic fragment. We do this using Gibson Assembly Master Mix from NEB, which allows several DNA fragments to be assembled in a single step.  Other cloning methods could be used instead but are likely to be slower and more labor-intensive.  
Technical Tips for Gibson Assembly   
  • In brief, Gibson Assembly works by stitching together PCR fragments that have overlapping ends.  You’ll produce several PCR fragments for the sequences you want to insert into the genome, along with a large PCR product comprising the vector background and recombination arms (see the figure on the previous page).  
  • Design primers so that the fragments you want to assemble overlap by at least 30 bp.  The NEB protocol says that 20 bp is enough, but we have had better luck with longer overlaps.
  • In our experience, the biggest issue with Gibson Assembly is that one often sees a large number of colonies that are just parent vector.  Treating all PCR fragments with DpnI, followed by gel extraction, has proven to be an effective way of eliminating this background.  
  • The efficiency of assembling the desired product appears to drop off exponentially with the number of fragments being assembled.  In our hands, 2-3 fragment assemblies almost always work, 4-6 fragment assemblies are tricky, and more than 6 is almost impossible (note that the vector counts as a fragment).  If you have trouble assembling your entire construct in one shot, try assembling a few pieces at a time to make larger pieces, and then PCR amplify and assemble the larger pieces.  



2) Choose the Cas9 target site 
Target sites conform to the pattern 5’G-(N19-25)-NGG-3’, where N is any base.  We strongly recommend using the Zhang lab's CRISPR design tool to find a specific Cas9 target.  Here are the detailed steps involved:
  • Identify a 200–250 bp region in which the Cas9 target site should be located.  This region and the selectable marker should be at opposite ends of the homologous repair template, so that all desired genomic modifications are located between the Cas9 target site and the selectable marker.  For example, for C-terminal GFP insertions, we use a Cas9 target sequence at or near the 3’ end of the coding sequence, upstream of the 3’UTR, and place the unc-119(+) cassette downstream of the 3’UTR in the repair template.  The desired modification (GFP insertion) lies between the Cas9 target site and the unc-119(+) marker.  For point mutations, the target sequence should be located at or near the 5’ end of the region containing the desired mutation(s), and the unc-119(+) cassette should be 3’ of the desired mutations in the repair template.  The desired mutations are between the Cas9 target site and the unc-119(+) marker. 
  • Submit this 200–250 bp genomic sequence to the Zhang lab’s CRISPR design tool.  Make sure you have selected C. elegans as the genome for checking specificity.   
  • The design tool returns a list of potential targeting sequences, ranked in order of predicted specificity.  We usually choose the most specific target unless we have a reason to do otherwise.  For the targeting sequence you choose, copy and paste the list of potential off-target sites into a Word document or Excel sheet and save this list for future reference. 
  • The design tool returns target sites of the form 5’(N20)-NGG-3’, where N is any base.  Target sites in our Cas9–sgRNA construct must begin with a G in order to be transcribed by the U6 promoter.  If the target site you chose already begins with a G, you are done; go on to the next step.  If not, lengthen the targeting sequence by adding nucleotides to the 5’ end (the opposite end from the NGG) so that the targeting sequence does begin with a G.  Your targeting sequence should then conform to the pattern 5’G-(N19-25)-NGG-3’.  Note that in our original paper, we tested only targeting sequences of the form 5’G-N19-NGG-3’; however, new data from Feng Zhang’s lab (Hsu et al. Nature Biotechnology 2013) suggests that addition of more nucleotides to the 5’ end of the targeting sequence does not adversely affect Cas9 activity or specificity. 

3) Add the targeting sequence to the Cas9-sgRNA construct
We use NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549).  Use forward primer 5’-(N19-25)GTTTTAGAGCTAGAAATAGCAAGT-3’, where (N19-25) is replaced by the desired 19-25 bp targeting sequence, and reverse primer 5’-CAAGACATCTCGCAATAGG-3’.  Note that the initial G in the G(N19-25) sequence is included in the reverse primer. 
IMPORTANT:  Do not include the PAM (NGG motif) in your primers for the Cas9-sgRNA construct.  The NGG motif must be present in the target DNA, but it is not part of the sgRNA. 
We use sequencing primer GGTGTGAAATACCGCACAGA to verify correct insertion of the targeting sequence. 

▸  Cas9-triggered homologous recombination with unc-119 selection

▸  Removal of the unc-119(+) cassette with Cre recombinase