Only a few steps are required to modify the genome with Cas9-triggered homologous recombination.
Expand the items below to view a protocol for each step, or download our Cloning Guide and Injection Protocols.
Expand the items below to view a protocol for each step, or download our Cloning Guide and Injection Protocols.
▾ Construct design and cloning
Preparing constructs for Cas9-triggered homologous recombination involves 3 steps:
Technical Tips for Gibson Assembly
2) Choose the Cas9 target site Target sites conform to the pattern 5’G-(N19-25)-NGG-3’, where N is any base. We strongly recommend using the Zhang lab's CRISPR design tool to find a specific Cas9 target. Here are the detailed steps involved:
We use NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549). Use forward primer 5’-(N19-25)GTTTTAGAGCTAGAAATAGCAAGT-3’, where (N19-25) is replaced by the desired 19-25 bp targeting sequence, and reverse primer 5’-CAAGACATCTCGCAATAGG-3’. Note that the initial G in the G(N19-25) sequence is included in the reverse primer. IMPORTANT: Do not include the PAM (NGG motif) in your primers for the Cas9-sgRNA construct. The NGG motif must be present in the target DNA, but it is not part of the sgRNA. We use sequencing primer GGTGTGAAATACCGCACAGA to verify correct insertion of the targeting sequence. |